ID: 1122888798_1122888810

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1122888798 1122888810
Species Human (GRCh38) Human (GRCh38)
Location 14:104723406-104723428 14:104723433-104723455
Sequence CCTCTGGGGCCTAGTCCCTCCAC TGGGCCGGGAAGGTCTGGTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!