ID: 1122968685_1122968695

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1122968685 1122968695
Species Human (GRCh38) Human (GRCh38)
Location 14:105143757-105143779 14:105143789-105143811
Sequence CCGGGGTCCTGCAGTGGCGACTT GCAGTGAGTGGGGAGTAGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 106} {0: 1, 1: 0, 2: 1, 3: 32, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!