ID: 1122968691_1122968707

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1122968691 1122968707
Species Human (GRCh38) Human (GRCh38)
Location 14:105143782-105143804 14:105143833-105143855
Sequence CCACCAGGCAGTGAGTGGGGAGT CTGTCCCCATCCGGGCACACAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 22, 4: 182} {0: 1, 1: 0, 2: 2, 3: 13, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!