ID: 1122968692_1122968705

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1122968692 1122968705
Species Human (GRCh38) Human (GRCh38)
Location 14:105143785-105143807 14:105143824-105143846
Sequence CCAGGCAGTGAGTGGGGAGTAGC GGGTGGAGGCTGTCCCCATCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 216} {0: 1, 1: 1, 2: 4, 3: 22, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!