ID: 1123116983_1123116992

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1123116983 1123116992
Species Human (GRCh38) Human (GRCh38)
Location 14:105899291-105899313 14:105899337-105899359
Sequence CCAGGCGGTCCTGGTTTGGGGTT GGCCTGTGTGTAAGTGGACGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!