ID: 1123208562_1123208570

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1123208562 1123208570
Species Human (GRCh38) Human (GRCh38)
Location 14:106737360-106737382 14:106737385-106737407
Sequence CCCCAGGCTTCTTCACCTCAGCC AGACTGTACCAGCTGGACCTCGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 13, 3: 24, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!