ID: 1123469001_1123469006

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1123469001 1123469006
Species Human (GRCh38) Human (GRCh38)
Location 15:20536320-20536342 15:20536339-20536361
Sequence CCCCGGGGCTGCAGCTGCTCACC CACCTGTGGCAGCAGGAGCTTGG
Strand - +
Off-target summary {0: 6, 1: 4, 2: 4, 3: 34, 4: 394} {0: 6, 1: 3, 2: 3, 3: 54, 4: 446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!