|
Left Crispr |
Right Crispr |
Crispr ID |
1123469003 |
1123469006 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:20536322-20536344
|
15:20536339-20536361
|
Sequence |
CCGGGGCTGCAGCTGCTCACCTG |
CACCTGTGGCAGCAGGAGCTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 6, 1: 4, 2: 7, 3: 74, 4: 661} |
{0: 6, 1: 3, 2: 3, 3: 54, 4: 446} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|