ID: 1123480694_1123480708

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1123480694 1123480708
Species Human (GRCh38) Human (GRCh38)
Location 15:20628764-20628786 15:20628813-20628835
Sequence CCGGGACTGCGCCGCTCACAGCG GGCAGTGGCGGTGGCGGCCATGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 10, 3: 138, 4: 1040}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!