ID: 1123649566_1123649573

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1123649566 1123649573
Species Human (GRCh38) Human (GRCh38)
Location 15:22467363-22467385 15:22467382-22467404
Sequence CCGAGATGGCCCACCAATAGTTG GTTGCAGGAGACCCGGTTGAGGG
Strand - +
Off-target summary {0: 4, 1: 3, 2: 1, 3: 17, 4: 57} {0: 6, 1: 0, 2: 2, 3: 30, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!