ID: 1123718058_1123718072

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1123718058 1123718072
Species Human (GRCh38) Human (GRCh38)
Location 15:23044050-23044072 15:23044087-23044109
Sequence CCCCACCTGGCCAGGGGTGCTGG CTCACCTGGCCAGAGGTGCTGGG
Strand - +
Off-target summary {0: 3, 1: 76, 2: 76, 3: 126, 4: 680} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!