ID: 1123721395_1123721403

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1123721395 1123721403
Species Human (GRCh38) Human (GRCh38)
Location 15:23064666-23064688 15:23064691-23064713
Sequence CCAGAAACACCTTGGCCCCTCTA CCGGCAAATTCCTAAATCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 38, 4: 167} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!