|
Left Crispr |
Right Crispr |
| Crispr ID |
1123908497 |
1123908501 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:24943643-24943665
|
15:24943657-24943679
|
| Sequence |
CCAGTAGCAGGCCAACAGCTGTT |
ACAGCTGTTTCTCAAAAGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 10, 2: 54, 3: 258, 4: 328} |
{0: 1, 1: 6, 2: 7, 3: 34, 4: 378} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|