ID: 1124014224_1124014238

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1124014224 1124014238
Species Human (GRCh38) Human (GRCh38)
Location 15:25862634-25862656 15:25862676-25862698
Sequence CCCGCCCAACTCACCTGCTGAAG TGATCTTGTGGTCGGAGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 305} {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!