ID: 1124249320_1124249331

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1124249320 1124249331
Species Human (GRCh38) Human (GRCh38)
Location 15:28096843-28096865 15:28096866-28096888
Sequence CCCCGGGACTGGCGGCCCCGCGG CAGGCCAGGCGCACCTCTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 164} {0: 1, 1: 0, 2: 1, 3: 6, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!