ID: 1124249322_1124249329

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1124249322 1124249329
Species Human (GRCh38) Human (GRCh38)
Location 15:28096844-28096866 15:28096864-28096886
Sequence CCCGGGACTGGCGGCCCCGCGGC GGCAGGCCAGGCGCACCTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 230} {0: 1, 1: 0, 2: 1, 3: 15, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!