ID: 1124282843_1124282854

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1124282843 1124282854
Species Human (GRCh38) Human (GRCh38)
Location 15:28378942-28378964 15:28378994-28379016
Sequence CCCACCAAAGTTTTGTCAGTCAG CTGCCCTCACCAATCACCCCAGG
Strand - +
Off-target summary {0: 9, 1: 14, 2: 11, 3: 21, 4: 98} {0: 7, 1: 4, 2: 42, 3: 30, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!