|
Left Crispr |
Right Crispr |
| Crispr ID |
1124299845 |
1124299850 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:28532619-28532641
|
15:28532643-28532665
|
| Sequence |
CCTGGGGTGATTGGTGAGGGCAG |
GACTGGGCTGCTTGCTGAAGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 4, 2: 42, 3: 30, 4: 297} |
{0: 22, 1: 8, 2: 6, 3: 20, 4: 185} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|