|
Left Crispr |
Right Crispr |
| Crispr ID |
1124321107 |
1124321115 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
15:28712069-28712091
|
15:28712097-28712119
|
| Sequence |
CCTGGGGTGATTGGCGAGGGCAA |
GGGCTGCTTTCTGAAGGGGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 10, 1: 0, 2: 20, 3: 21, 4: 104} |
{0: 4, 1: 21, 2: 7, 3: 26, 4: 260} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|