ID: 1124328822_1124328837

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1124328822 1124328837
Species Human (GRCh38) Human (GRCh38)
Location 15:28789548-28789570 15:28789591-28789613
Sequence CCCAGATCATGGCGCCGCAGCAG GACGGGGATGGTTCCCCAGGAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 1, 3: 9, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!