ID: 1124445855_1124445858

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1124445855 1124445858
Species Human (GRCh38) Human (GRCh38)
Location 15:29731240-29731262 15:29731262-29731284
Sequence CCAGGAGGAGGGATTCCTTGACT TTTGACACACATGGCCACCTTGG
Strand - +
Off-target summary {0: 1, 1: 22, 2: 16, 3: 24, 4: 154} {0: 20, 1: 14, 2: 7, 3: 12, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!