ID: 1124487840_1124487846

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1124487840 1124487846
Species Human (GRCh38) Human (GRCh38)
Location 15:30135358-30135380 15:30135382-30135404
Sequence CCCCTTCAGCAAGCAGCCCAGTC TTGCCCTCGCCAATCACCCCAGG
Strand - +
Off-target summary {0: 22, 1: 8, 2: 6, 3: 20, 4: 185} {0: 10, 1: 0, 2: 20, 3: 21, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!