ID: 1124488221_1124488227

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1124488221 1124488227
Species Human (GRCh38) Human (GRCh38)
Location 15:30137907-30137929 15:30137926-30137948
Sequence CCCTACATCATCTGCTACCCTGA CTGAAAGATCTGGAGGTAAGAGG
Strand - +
Off-target summary {0: 21, 1: 1, 2: 7, 3: 12, 4: 148} {0: 10, 1: 12, 2: 24, 3: 28, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!