ID: 1124536837_1124536845

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1124536837 1124536845
Species Human (GRCh38) Human (GRCh38)
Location 15:30554815-30554837 15:30554852-30554874
Sequence CCACAGGGAAGGCCCTACATCAT GATCTGGAGGTAAGAGGCTCTGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 4, 3: 14, 4: 122} {0: 18, 1: 20, 2: 6, 3: 24, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!