ID: 1124543311_1124543315

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1124543311 1124543315
Species Human (GRCh38) Human (GRCh38)
Location 15:30606869-30606891 15:30606893-30606915
Sequence CCACAGGGAAGGCCCTACATCAT TGCTACCCTGAAAGATCTGGAGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 4, 3: 14, 4: 122} {0: 10, 1: 12, 2: 12, 3: 20, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!