ID: 1124551173_1124551178

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1124551173 1124551178
Species Human (GRCh38) Human (GRCh38)
Location 15:30682609-30682631 15:30682638-30682660
Sequence CCATGGTCCTCATGGTGGAATCA TAGCTAGTAGGAAGGACTGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 10, 4: 173} {0: 2, 1: 0, 2: 2, 3: 16, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!