ID: 1124553190_1124553195

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1124553190 1124553195
Species Human (GRCh38) Human (GRCh38)
Location 15:30701325-30701347 15:30701366-30701388
Sequence CCTGATACAGGCAGTACTTAAGG AAGAGCTGTAAAGGGTCTCCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 77} {0: 2, 1: 0, 2: 1, 3: 18, 4: 584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!