ID: 1124554529_1124554531

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1124554529 1124554531
Species Human (GRCh38) Human (GRCh38)
Location 15:30712147-30712169 15:30712160-30712182
Sequence CCAGCCACATTCTGCATTTCAGA GCATTTCAGAGCCAGAATACAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 36, 4: 337} {0: 2, 1: 0, 2: 1, 3: 22, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!