ID: 1124640360_1124640382

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1124640360 1124640382
Species Human (GRCh38) Human (GRCh38)
Location 15:31392817-31392839 15:31392868-31392890
Sequence CCGCCCCCGCCCCCGCCCCCGCC TGCCGTGAGCCGGTCCGAAACGG
Strand - +
Off-target summary {0: 97, 1: 169, 2: 637, 3: 4863, 4: 13574} {0: 1, 1: 1, 2: 0, 3: 1, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!