ID: 1124640370_1124640382

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1124640370 1124640382
Species Human (GRCh38) Human (GRCh38)
Location 15:31392832-31392854 15:31392868-31392890
Sequence CCCCCGCCCGCGACGCTTCCGGG TGCCGTGAGCCGGTCCGAAACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 127} {0: 1, 1: 1, 2: 0, 3: 1, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!