ID: 1124776814_1124776825

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1124776814 1124776825
Species Human (GRCh38) Human (GRCh38)
Location 15:32596292-32596314 15:32596336-32596358
Sequence CCACAGGGAAGGCCCTACATCAT AGGTAAGAGGCTCTGGGTGGAGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 4, 3: 14, 4: 122} {0: 2, 1: 7, 2: 15, 3: 47, 4: 389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!