ID: 1124979210_1124979221

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1124979210 1124979221
Species Human (GRCh38) Human (GRCh38)
Location 15:34556019-34556041 15:34556058-34556080
Sequence CCTGCGGCCAGAGAGCCCCACGC CCACAACCACAGCCCCGATGGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 15, 4: 168} {0: 3, 1: 0, 2: 0, 3: 6, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!