ID: 1124983283_1124983291

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1124983283 1124983291
Species Human (GRCh38) Human (GRCh38)
Location 15:34583348-34583370 15:34583364-34583386
Sequence CCCAGCGGCGGCCTCCCCGCAGC CCGCAGCCCCGCCGAGTCCGGGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 0, 3: 23, 4: 232} {0: 2, 1: 0, 2: 1, 3: 14, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!