ID: 1125004219_1125004224

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1125004219 1125004224
Species Human (GRCh38) Human (GRCh38)
Location 15:34799595-34799617 15:34799630-34799652
Sequence CCTCCCCGGCACTGGGGGATTAG TCAGCTGTTCCTCCGTTCGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 4, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!