ID: 1125381595_1125381599

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1125381595 1125381599
Species Human (GRCh38) Human (GRCh38)
Location 15:39092435-39092457 15:39092448-39092470
Sequence CCTCCAGCCTTCAGACCCTCCCT GACCCTCCCTGGCCTGAAGCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!