ID: 1125626816_1125626835

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1125626816 1125626835
Species Human (GRCh38) Human (GRCh38)
Location 15:41115942-41115964 15:41115991-41116013
Sequence CCGTTCGCCCGCCCACGTCTAGT GCCGCCGCGACGGCGGCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35} {0: 1, 1: 0, 2: 1, 3: 38, 4: 559}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!