ID: 1125626816_1125626839

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1125626816 1125626839
Species Human (GRCh38) Human (GRCh38)
Location 15:41115942-41115964 15:41115994-41116016
Sequence CCGTTCGCCCGCCCACGTCTAGT GCCGCGACGGCGGCGGAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35} {0: 1, 1: 1, 2: 13, 3: 141, 4: 810}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!