ID: 1125626820_1125626829

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1125626820 1125626829
Species Human (GRCh38) Human (GRCh38)
Location 15:41115954-41115976 15:41115984-41116006
Sequence CCACGTCTAGTTGCCTCACCTCG TGGCCCCGCCGCCGCGACGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37} {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!