ID: 1125626825_1125626831

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1125626825 1125626831
Species Human (GRCh38) Human (GRCh38)
Location 15:41115972-41115994 15:41115987-41116009
Sequence CCTCGGGCCGCCTGGCCCCGCCG CCCCGCCGCCGCGACGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 525} {0: 1, 1: 0, 2: 1, 3: 55, 4: 431}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!