ID: 1125626826_1125626844

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1125626826 1125626844
Species Human (GRCh38) Human (GRCh38)
Location 15:41115979-41116001 15:41116000-41116022
Sequence CCGCCTGGCCCCGCCGCCGCGAC ACGGCGGCGGAGGGGGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 458} {0: 1, 1: 0, 2: 10, 3: 131, 4: 1062}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!