ID: 1125626828_1125626842

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1125626828 1125626842
Species Human (GRCh38) Human (GRCh38)
Location 15:41115982-41116004 15:41115998-41116020
Sequence CCTGGCCCCGCCGCCGCGACGGC CGACGGCGGCGGAGGGGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 91, 4: 646} {0: 1, 1: 0, 2: 10, 3: 169, 4: 1260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!