ID: 1125626830_1125626849

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1125626830 1125626849
Species Human (GRCh38) Human (GRCh38)
Location 15:41115987-41116009 15:41116011-41116033
Sequence CCCCGCCGCCGCGACGGCGGCGG GGGGGGGCGGGGTGCGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 432} {0: 1, 1: 3, 2: 58, 3: 599, 4: 4071}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!