ID: 1125769633_1125769645

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1125769633 1125769645
Species Human (GRCh38) Human (GRCh38)
Location 15:42156494-42156516 15:42156542-42156564
Sequence CCCAGGAGGGGCAGCATCTTGTC CAAAGCATGGCTGGGCAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 200} {0: 1, 1: 0, 2: 2, 3: 25, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!