ID: 1126295205_1126295210 |
View in Genome Browser |
Spacer: -4 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1126295205 | 1126295210 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 15:47131773-47131795 | 15:47131792-47131814 |
| Sequence | CCTTCCACGGTCTCCCTCTGATG | GATGCCGAGCCAAAGCTGGACGG |
| Strand | - | + |
| Off-target summary | {0: 87, 1: 19, 2: 6, 3: 18, 4: 219} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||