ID: 1126295205_1126295213

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1126295205 1126295213
Species Human (GRCh38) Human (GRCh38)
Location 15:47131773-47131795 15:47131809-47131831
Sequence CCTTCCACGGTCTCCCTCTGATG GGACGGTACTGCTGCCATCTCGG
Strand - +
Off-target summary {0: 87, 1: 19, 2: 6, 3: 18, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!