|
Left Crispr |
Right Crispr |
Crispr ID |
1127356911 |
1127356917 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:58209162-58209184
|
15:58209200-58209222
|
Sequence |
CCTGCCATCTTCTGCAGATAACT |
GACAGCTCTTGGCCTGTTATTGG |
Strand |
- |
+ |
Off-target summary |
{0: 185, 1: 187, 2: 104, 3: 111, 4: 225} |
{0: 7, 1: 169, 2: 190, 3: 150, 4: 253} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|