ID: 1127410212_1127410219

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1127410212 1127410219
Species Human (GRCh38) Human (GRCh38)
Location 15:58697750-58697772 15:58697786-58697808
Sequence CCCAAGAATCAGCCCACCTGGAC TGCCAGCATATGTTGCCCTAAGG
Strand - +
Off-target summary {0: 5, 1: 11, 2: 32, 3: 70, 4: 268} {0: 1, 1: 0, 2: 7, 3: 17, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!