ID: 1127753518_1127753540

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1127753518 1127753540
Species Human (GRCh38) Human (GRCh38)
Location 15:62068279-62068301 15:62068328-62068350
Sequence CCCGGCCCGGGCCCCCTCCACGA CCCGAGCGCCTGGAGGCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 348} {0: 1, 1: 0, 2: 1, 3: 9, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!