ID: 1127753521_1127753543

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1127753521 1127753543
Species Human (GRCh38) Human (GRCh38)
Location 15:62068285-62068307 15:62068336-62068358
Sequence CCGGGCCCCCTCCACGAGCCCGC CCTGGAGGCCGAGGGCACCGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 31, 4: 378} {0: 1, 1: 1, 2: 2, 3: 36, 4: 359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!