ID: 1127753523_1127753545

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1127753523 1127753545
Species Human (GRCh38) Human (GRCh38)
Location 15:62068291-62068313 15:62068343-62068365
Sequence CCCCTCCACGAGCCCGCCGTCGT GCCGAGGGCACCGTGGCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53} {0: 1, 1: 1, 2: 1, 3: 11, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!